Transcript: Human XM_011515535.2

PREDICTED: Homo sapiens tweety family member 3 (TTYH3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTYH3 (80727)
Length:
1853
CDS:
156..1736

Additional Resources:

NCBI RefSeq record:
XM_011515535.2
NBCI Gene record:
TTYH3 (80727)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515535.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000443930 AGACCAGTGATGGCATCCATA pLKO_005 484 CDS 100% 4.950 6.930 N TTYH3 n/a
2 TRCN0000424397 GCATCGCAGTGGGATTCTACG pLKO_005 454 CDS 100% 1.350 1.890 N TTYH3 n/a
3 TRCN0000143083 CATGAGCCAGAACGCTAATTT pLKO.1 1577 CDS 100% 15.000 10.500 N TTYH3 n/a
4 TRCN0000141879 GTACATGAGCCAGAACGCTAA pLKO.1 1574 CDS 100% 4.050 2.835 N TTYH3 n/a
5 TRCN0000122420 GCACTGGTGGAGATGCAGGAT pLKO.1 1104 CDS 100% 0.880 0.616 N TTYH3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515535.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04217 pDONR223 100% 94.4% 94.2% None (many diffs) n/a
2 ccsbBroad304_04217 pLX_304 0% 94.4% 94.2% V5 (many diffs) n/a
3 TRCN0000475677 ATGTGTATCGAGCCACTTTTTTAC pLX_317 20.3% 94.4% 94.2% V5 (many diffs) n/a
Download CSV