Transcript: Human XM_011515907.2

PREDICTED: Homo sapiens zinc finger and SCAN domain containing 25 (ZSCAN25), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZSCAN25 (221785)
Length:
4605
CDS:
583..2217

Additional Resources:

NCBI RefSeq record:
XM_011515907.2
NBCI Gene record:
ZSCAN25 (221785)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515907.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107694 GAACCCACGAAGAGAAGTCTT pLKO.1 1685 CDS 100% 4.950 6.930 N ZSCAN25 n/a
2 TRCN0000107693 GTTGGGTATTCCTGTGGTGAA pLKO.1 627 CDS 100% 4.050 5.670 N ZSCAN25 n/a
3 TRCN0000244962 ACCCACGAAGAGAAGTCTTAT pLKO_005 1687 CDS 100% 13.200 9.240 N ZSCAN25 n/a
4 TRCN0000244960 AGATGGCAGCTGGGTTCTTTA pLKO_005 1229 CDS 100% 13.200 9.240 N ZSCAN25 n/a
5 TRCN0000107692 CCAGCCCAGATAGACTGCTTT pLKO.1 1327 CDS 100% 4.950 3.465 N ZSCAN25 n/a
6 TRCN0000107691 CCTGAGAGAATACCTGATGAA pLKO.1 1737 CDS 100% 4.950 3.465 N ZSCAN25 n/a
7 TRCN0000107690 GCCCACTTTGAAACGTGGTTT pLKO.1 3884 3UTR 100% 4.950 3.465 N ZSCAN25 n/a
8 TRCN0000244961 ACTGACATCAGAGAGGTTTGG pLKO_005 1452 CDS 100% 4.050 2.835 N ZSCAN25 n/a
9 TRCN0000244963 CTAGTATTAATGCCCTATATT pLKO_005 3106 3UTR 100% 0.000 0.000 N ZSCAN25 n/a
10 TRCN0000244959 CTCAGCAGCAGTTGGGTATTC pLKO_005 617 CDS 100% 10.800 6.480 N ZSCAN25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515907.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14441 pDONR223 100% 85.4% 85.4% None 1_21del;588_803del n/a
Download CSV