Transcript: Human XM_011516055.2

PREDICTED: Homo sapiens zinc finger protein 777 (ZNF777), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF777 (27153)
Length:
3082
CDS:
174..2669

Additional Resources:

NCBI RefSeq record:
XM_011516055.2
NBCI Gene record:
ZNF777 (27153)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015898 CGATGGGATCGTGATTAAGAT pLKO.1 1265 CDS 100% 5.625 7.875 N ZNF777 n/a
2 TRCN0000413119 TGTTCCAATCCCGCGTTCTTC pLKO_005 268 CDS 100% 4.950 6.930 N ZNF777 n/a
3 TRCN0000416082 TTCCATGGACTATGCAATTTC pLKO_005 1139 CDS 100% 13.200 10.560 N ZNF777 n/a
4 TRCN0000225776 CTGTTAATTTCCTTGACAATA pLKO_005 2908 3UTR 100% 13.200 9.240 N Zfp777 n/a
5 TRCN0000426165 TTCCACAAGAAGAAACCTTAC pLKO_005 214 CDS 100% 6.000 4.200 N ZNF777 n/a
6 TRCN0000418822 ACCAGACCTCATGTCACAGAT pLKO_005 1163 CDS 100% 4.950 3.465 N ZNF777 n/a
7 TRCN0000428875 AGATAGCCGACTGCGAGAAGA pLKO_005 829 CDS 100% 4.950 3.465 N ZNF777 n/a
8 TRCN0000015901 CGGGAGATATGAGGCCAGTAT pLKO.1 1610 CDS 100% 4.950 3.465 N ZNF777 n/a
9 TRCN0000422616 ACATCAGCTTGGTGATCCATC pLKO_005 2200 CDS 100% 4.050 2.835 N ZNF777 n/a
10 TRCN0000015902 CCGCCTGAAGATCAACCTCAT pLKO.1 1838 CDS 100% 4.050 2.835 N ZNF777 n/a
11 TRCN0000015899 CCCGGCAGCAATGGAGAAGTT pLKO.1 993 CDS 100% 1.650 1.155 N ZNF777 n/a
12 TRCN0000015900 GCTGTTAATTTCCTTGACAAT pLKO.1 2907 3UTR 100% 4.950 2.970 N ZNF777 n/a
13 TRCN0000430878 TGGATGAAACCAATCAGCACG pLKO_005 2932 3UTR 100% 2.160 1.296 N ZNF777 n/a
14 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 1549 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11850 pDONR223 100% 62.2% 62.2% None 1_939del;1534G>A n/a
2 ccsbBroad304_11850 pLX_304 0% 62.2% 62.2% V5 1_939del;1534G>A n/a
3 TRCN0000477135 ATATCTGAGAGTGTTTGCAGCCTA pLX_317 21.6% 62.2% 62.2% V5 1_939del;1534G>A n/a
Download CSV