Transcript: Human XM_011516140.2

PREDICTED: Homo sapiens killer cell lectin like receptor G2 (KLRG2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLRG2 (346689)
Length:
1347
CDS:
75..1121

Additional Resources:

NCBI RefSeq record:
XM_011516140.2
NBCI Gene record:
KLRG2 (346689)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516140.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244784 GGCTACCCATGTACGTGAAGT pLKO_005 832 CDS 100% 4.950 6.930 N KLRG2 n/a
2 TRCN0000244785 ACAACCTGAAGGTCCCGAAAG pLKO_005 191 CDS 100% 6.000 4.800 N KLRG2 n/a
3 TRCN0000244783 TTGTCCGAGGAGCACTGTTAC pLKO_005 969 CDS 100% 10.800 7.560 N KLRG2 n/a
4 TRCN0000257002 CATGGAGCTGCAGGTAGATGT pLKO_005 437 CDS 100% 4.950 2.970 N KLRG2 n/a
5 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 1154 3UTR 100% 10.800 5.400 Y MRPS16 n/a
6 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 1154 3UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516140.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05505 pDONR223 100% 82% 83.1% None (many diffs) n/a
2 ccsbBroad304_05505 pLX_304 0% 82% 83.1% V5 (many diffs) n/a
3 TRCN0000477831 ATACCTCGACAGGCTTTCCATGCA pLX_317 12.4% 82% 83.1% V5 (many diffs) n/a
Download CSV