Transcript: Human XM_011516448.3

PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type N2 (PTPRN2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPRN2 (5799)
Length:
2225
CDS:
128..2119

Additional Resources:

NCBI RefSeq record:
XM_011516448.3
NBCI Gene record:
PTPRN2 (5799)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516448.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235409 GGACGACGATGATAGACTTTA pLKO_005 1273 CDS 100% 13.200 18.480 N PTPRN2 n/a
2 TRCN0000235408 TCACGTGGCAGGATGACTATA pLKO_005 408 CDS 100% 13.200 18.480 N PTPRN2 n/a
3 TRCN0000235407 CGTCAAGAGCCAGACGTATTC pLKO_005 1465 CDS 100% 10.800 15.120 N PTPRN2 n/a
4 TRCN0000003251 CAAGAGCCAGACGTATTCCAA pLKO.1 1468 CDS 100% 3.000 4.200 N PTPRN2 n/a
5 TRCN0000003249 CGACGATGATAGACTTTACCA pLKO.1 1276 CDS 100% 3.000 4.200 N PTPRN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516448.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488930 CTCCCAAGGCGTAGTCAGACACGA pLX_317 11% 61.3% 57.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV