Transcript: Human XM_011516469.3

PREDICTED: Homo sapiens polypeptide N-acetylgalactosaminyltransferase 17 (GALNT17), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GALNT17 (64409)
Length:
2541
CDS:
399..1376

Additional Resources:

NCBI RefSeq record:
XM_011516469.3
NBCI Gene record:
GALNT17 (64409)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011516469.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156028 CCATGAGAAGTATGGCTACAA pLKO.1 740 CDS 100% 4.950 3.465 N GALNT17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011516469.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08854 pDONR223 100% 54.2% 53.5% None (many diffs) n/a
2 ccsbBroad304_08854 pLX_304 0% 54.2% 53.5% V5 (many diffs) n/a
3 TRCN0000477589 TCGAAATTATAATTCTGGCCCTCA pLX_317 28.2% 54.2% 53.5% V5 (many diffs) n/a
Download CSV