Transcript: Human XM_011517004.2

PREDICTED: Homo sapiens heat shock transcription factor 1 (HSF1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HSF1 (3297)
Length:
1759
CDS:
329..1369

Additional Resources:

NCBI RefSeq record:
XM_011517004.2
NBCI Gene record:
HSF1 (3297)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517004.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007480 GCAGGTTGTTCATAGTCAGAA pLKO.1 1618 3UTR 100% 4.950 6.930 N HSF1 n/a
2 TRCN0000318712 GCAGGTTGTTCATAGTCAGAA pLKO_005 1618 3UTR 100% 4.950 6.930 N HSF1 n/a
3 TRCN0000007481 GCACATTCCATGCCCAAGTAT pLKO.1 350 CDS 100% 5.625 3.938 N HSF1 n/a
4 TRCN0000318652 GCACATTCCATGCCCAAGTAT pLKO_005 350 CDS 100% 5.625 3.938 N HSF1 n/a
5 TRCN0000007484 CAGTGACCACTTGGATGCTAT pLKO.1 931 CDS 100% 4.950 3.465 N HSF1 n/a
6 TRCN0000318711 CAGTGACCACTTGGATGCTAT pLKO_005 931 CDS 100% 4.950 3.465 N HSF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517004.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00794 pDONR223 100% 57% 56.9% None 0_1ins633;510_593del n/a
2 ccsbBroad304_00794 pLX_304 0% 57% 56.9% V5 0_1ins633;510_593del n/a
3 TRCN0000470291 TGGGTAATAACTGTGAGCGGGGTT pLX_317 29.7% 57% 56.9% V5 0_1ins633;510_593del n/a
Download CSV