Transcript: Human XM_011517096.2

PREDICTED: Homo sapiens regulator of microtubule dynamics 1 (RMDN1), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RMDN1 (51115)
Length:
3005
CDS:
99..1046

Additional Resources:

NCBI RefSeq record:
XM_011517096.2
NBCI Gene record:
RMDN1 (51115)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517096.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148167 GATGCTACTTCAATTCACCTT pLKO.1 750 CDS 100% 2.640 3.696 N RMDN1 n/a
2 TRCN0000147135 CTTTATCAGTTGCTAACCCAA pLKO.1 444 CDS 100% 2.640 2.112 N RMDN1 n/a
3 TRCN0000312469 CTTTATCAGTTGCTAACCCAA pLKO_005 444 CDS 100% 2.640 2.112 N RMDN1 n/a
4 TRCN0000148289 CCCTAAAGATGCTACTTCAAT pLKO.1 743 CDS 100% 5.625 3.938 N RMDN1 n/a
5 TRCN0000312417 CCCTAAAGATGCTACTTCAAT pLKO_005 743 CDS 100% 5.625 3.938 N RMDN1 n/a
6 TRCN0000189931 GCCACAGCCAAAGTTGAAGAA pLKO.1 375 CDS 100% 4.950 3.465 N Rmdn1 n/a
7 TRCN0000319811 GCCACAGCCAAAGTTGAAGAA pLKO_005 375 CDS 100% 4.950 3.465 N Rmdn1 n/a
8 TRCN0000148382 CCTTATGGGTATTTGGTGCTA pLKO.1 767 CDS 100% 2.640 1.848 N RMDN1 n/a
9 TRCN0000312419 CCTTATGGGTATTTGGTGCTA pLKO_005 767 CDS 100% 2.640 1.848 N RMDN1 n/a
10 TRCN0000146666 CTTCAATTCACCTTATGGGTA pLKO.1 757 CDS 100% 2.640 1.848 N RMDN1 n/a
11 TRCN0000312471 CTTCAATTCACCTTATGGGTA pLKO_005 757 CDS 100% 2.640 1.848 N RMDN1 n/a
12 TRCN0000040213 CCTCCCAAATTGCTGGGATTA pLKO.1 1825 3UTR 100% 1.080 0.540 Y IGF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517096.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03214 pDONR223 100% 91.7% 91.7% None 130_171del;800_801ins39 n/a
Download CSV