Transcript: Human XM_011517266.3

PREDICTED: Homo sapiens transcriptional repressor GATA binding 1 (TRPS1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRPS1 (7227)
Length:
9824
CDS:
415..4299

Additional Resources:

NCBI RefSeq record:
XM_011517266.3
NBCI Gene record:
TRPS1 (7227)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517266.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245307 TACTAGAATGTTGGCTATAAT pLKO_005 9627 3UTR 100% 15.000 21.000 N TRPS1 n/a
2 TRCN0000082333 CCTTAGCACTTAGCACAATTA pLKO.1 4302 3UTR 100% 13.200 18.480 N Trps1 n/a
3 TRCN0000245304 GGGTACTCAGTGCCCATAAAG pLKO_005 1687 CDS 100% 13.200 18.480 N TRPS1 n/a
4 TRCN0000245306 ACAACGGTGAGCAGATTATTA pLKO_005 3269 CDS 100% 15.000 10.500 N TRPS1 n/a
5 TRCN0000245305 ATATGGTAACGAGCTATAATT pLKO_005 2006 CDS 100% 15.000 10.500 N TRPS1 n/a
6 TRCN0000020498 CCTGCGAAACACCCAAATTAT pLKO.1 3673 CDS 100% 15.000 10.500 N TRPS1 n/a
7 TRCN0000418190 AGCATCTTTGCACGGACAAAT pLKO_005 4199 CDS 100% 13.200 9.240 N Trps1 n/a
8 TRCN0000020494 CGGACACAAATAGGTTCTTTA pLKO.1 6973 3UTR 100% 13.200 9.240 N TRPS1 n/a
9 TRCN0000020496 GCGGCCTTAATCCAGAGTTAA pLKO.1 1847 CDS 100% 13.200 9.240 N TRPS1 n/a
10 TRCN0000245303 GGCAACTCATCCACCGAATTA pLKO_005 1483 CDS 100% 13.200 9.240 N TRPS1 n/a
11 TRCN0000082337 CCCAGGCCTTTAAACATCATT pLKO.1 3241 CDS 100% 5.625 3.938 N Trps1 n/a
12 TRCN0000020497 CGGACAAATATGACTTCACAA pLKO.1 4211 CDS 100% 4.950 3.465 N TRPS1 n/a
13 TRCN0000020495 CCGCTGTAAATTCTGCAATTT pLKO.1 1452 CDS 100% 1.320 0.924 N TRPS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517266.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11204 pDONR223 100% 65.8% 65.9% None (many diffs) n/a
2 ccsbBroad304_11204 pLX_304 0% 65.8% 65.9% V5 (many diffs) n/a
3 TRCN0000473025 TACGCAACTGGGAAACCCCCGGTC pLX_317 21.4% 65.8% 65.9% V5 (many diffs) n/a
Download CSV