Transcript: Human XM_011517449.2

PREDICTED: Homo sapiens chromosome 8 open reading frame 34 (C8orf34), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C8orf34 (116328)
Length:
1555
CDS:
264..1508

Additional Resources:

NCBI RefSeq record:
XM_011517449.2
NBCI Gene record:
C8orf34 (116328)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517449.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421435 TGATAAACCTTGGCAATTAAA pLKO_005 773 CDS 100% 15.000 21.000 N C8orf34 n/a
2 TRCN0000417275 GAATTGCTGGAGGATCTTAAT pLKO_005 1359 CDS 100% 13.200 18.480 N C8orf34 n/a
3 TRCN0000283348 TAAACCACAAAGCCGTGATTT pLKO_005 911 CDS 100% 13.200 10.560 N A830018L16Rik n/a
4 TRCN0000147468 CAAAGGAACAAGAAGGGATTT pLKO.1 743 CDS 100% 10.800 7.560 N C8orf34 n/a
5 TRCN0000130578 CTAAACCACAAAGCCGTGATT pLKO.1 910 CDS 100% 4.950 3.465 N C8orf34 n/a
6 TRCN0000148947 CCCATTTCTCATTGACCATCT pLKO.1 635 CDS 100% 4.050 2.835 N C8orf34 n/a
7 TRCN0000129775 CCATTTCTCATTGACCATCTT pLKO.1 636 CDS 100% 4.950 2.970 N C8orf34 n/a
8 TRCN0000345844 GAGAATCTCTCTCGAAGTATC pLKO_005 984 CDS 100% 10.800 15.120 N A830018L16Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517449.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13059 pDONR223 100% 58.6% 58.6% None 1_258del;1242_1243ins435 n/a
2 ccsbBroad304_13059 pLX_304 0% 58.6% 58.6% V5 1_258del;1242_1243ins435 n/a
3 TRCN0000476227 CCTAAGGTCATGCATCTGCGGTTA pLX_317 29.8% 58.6% 58.6% V5 1_258del;1242_1243ins435 n/a
Download CSV