Transcript: Human XM_011517508.2

PREDICTED: Homo sapiens lymphocyte antigen 96 (LY96), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LY96 (23643)
Length:
684
CDS:
48..464

Additional Resources:

NCBI RefSeq record:
XM_011517508.2
NBCI Gene record:
LY96 (23643)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517508.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057009 CCGAGGATCTGATGACGATTA pLKO.1 332 CDS 100% 10.800 15.120 N LY96 n/a
2 TRCN0000057010 GCAACTCATCCGATGCAAGTA pLKO.1 121 CDS 100% 4.950 6.930 N LY96 n/a
3 TRCN0000372944 CCAAAGGATTATTGCACATTT pLKO_005 217 CDS 100% 13.200 9.240 N LY96 n/a
4 TRCN0000057011 GAGACTGTGAATACAACAATA pLKO.1 378 CDS 100% 13.200 9.240 N LY96 n/a
5 TRCN0000372880 CATTCTCCTTCAAGGGAATAA pLKO_005 400 CDS 100% 13.200 7.920 N LY96 n/a
6 TRCN0000057012 CCAAAGCGCAAAGAAGTTATT pLKO.1 309 CDS 100% 13.200 7.920 N LY96 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517508.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02819 pDONR223 100% 82.1% 77.1% None (many diffs) n/a
2 ccsbBroad304_02819 pLX_304 0% 82.1% 77.1% V5 (many diffs) n/a
3 TRCN0000472267 CCCAGACGAACGATGGATGAGGGA pLX_317 77.2% 82.1% 77.1% V5 (many diffs) n/a
Download CSV