Transcript: Human XM_011517523.3

PREDICTED: Homo sapiens interleukin 7 (IL7), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IL7 (3574)
Length:
2557
CDS:
1909..2337

Additional Resources:

NCBI RefSeq record:
XM_011517523.3
NBCI Gene record:
IL7 (3574)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517523.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059184 CGATCAATTATTGGACAGCAT pLKO.1 2043 CDS 100% 2.640 3.696 N IL7 n/a
2 TRCN0000059183 GCTCGCAAGTTGAGGCAATTT pLKO.1 2161 CDS 100% 13.200 10.560 N IL7 n/a
3 TRCN0000059187 TGATGCTAATAAGGAAGGTAT pLKO.1 2124 CDS 100% 4.950 3.465 N IL7 n/a
4 TRCN0000059185 GCATCATCTGATTGTGATATT pLKO.1 1975 CDS 100% 13.200 7.920 N IL7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517523.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00852 pDONR223 100% 78.2% 78.5% None 414_415insGA;417_422delTCTCGT;426_427ins109 n/a
2 ccsbBroad304_00852 pLX_304 0% 78.2% 78.5% V5 414_415insGA;417_422delTCTCGT;426_427ins109 n/a
3 TRCN0000472386 TTAATTATGACCACTACTTCATCA pLX_317 85.8% 78.2% 78.5% V5 414_415insGA;417_422delTCTCGT;426_427ins109 n/a
Download CSV