Transcript: Human XM_011517623.3

PREDICTED: Homo sapiens gamma-glutamyl hydrolase (GGH), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GGH (8836)
Length:
1786
CDS:
35..850

Additional Resources:

NCBI RefSeq record:
XM_011517623.3
NBCI Gene record:
GGH (8836)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517623.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051342 GTGCGAGAGTTGTACCAGTAA pLKO.1 237 CDS 100% 4.950 6.930 N GGH n/a
2 TRCN0000300996 GTGCGAGAGTTGTACCAGTAA pLKO_005 237 CDS 100% 4.950 6.930 N GGH n/a
3 TRCN0000051341 GATGGCAAGATTGAGTTTATT pLKO.1 698 CDS 100% 15.000 10.500 N GGH n/a
4 TRCN0000300997 GATGGCAAGATTGAGTTTATT pLKO_005 698 CDS 100% 15.000 10.500 N GGH n/a
5 TRCN0000051338 GCTTATTAACTGCCACAGATA pLKO.1 477 CDS 100% 4.950 3.465 N GGH n/a
6 TRCN0000300995 GCTTATTAACTGCCACAGATA pLKO_005 477 CDS 100% 4.950 3.465 N GGH n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1668 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517623.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02029 pDONR223 100% 81.3% 72.7% None (many diffs) n/a
2 ccsbBroad304_02029 pLX_304 0% 81.3% 72.7% V5 (many diffs) n/a
3 TRCN0000472249 GACTCGTCGCGGCACAGCATGTTC pLX_317 36.9% 81.3% 72.7% V5 (many diffs) n/a
Download CSV