Transcript: Human XM_011517702.3

PREDICTED: Homo sapiens insulin like 6 (INSL6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
INSL6 (11172)
Length:
506
CDS:
106..486

Additional Resources:

NCBI RefSeq record:
XM_011517702.3
NBCI Gene record:
INSL6 (11172)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517702.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159571 CACTACCTGAGTATAAGGATA pLKO.1 440 CDS 100% 4.950 6.930 N INSL6 n/a
2 TRCN0000159519 CAGGTACTTGGTGAAAGAAAT pLKO.1 207 CDS 100% 13.200 9.240 N INSL6 n/a
3 TRCN0000160907 GCAGTCACTACCTGAGTATAA pLKO.1 435 CDS 100% 13.200 9.240 N INSL6 n/a
4 TRCN0000161108 GCAGGTACTTGGTGAAAGAAA pLKO.1 206 CDS 100% 5.625 3.938 N INSL6 n/a
5 TRCN0000158886 GTACTTGGTGAAAGAAATAGA pLKO.1 210 CDS 100% 5.625 3.938 N INSL6 n/a
6 TRCN0000164871 GCACAAACCCAGTGTCTACTT pLKO.1 383 CDS 100% 4.950 3.465 N INSL6 n/a
7 TRCN0000160984 GTGTCTACTTCTTGGGAAGAA pLKO.1 394 CDS 100% 4.950 3.465 N INSL6 n/a
8 TRCN0000165693 CCAGTGTCTACTTCTTGGGAA pLKO.1 391 CDS 100% 2.640 1.848 N INSL6 n/a
9 TRCN0000161505 GAAGCAGTAAACAGTTGGGAA pLKO.1 412 CDS 100% 2.640 1.848 N INSL6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517702.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02642 pDONR223 100% 58.9% 58.6% None 377delT;378_379ins262 n/a
2 ccsbBroad304_02642 pLX_304 0% 58.9% 58.6% V5 377delT;378_379ins262 n/a
3 TRCN0000467499 ACCTAAGGCAATAACAACCCGGAG pLX_317 57.4% 58.9% 58.6% V5 377delT;378_379ins262 n/a
Download CSV