Transcript: Human XM_011518278.2

PREDICTED: Homo sapiens adenylate kinase 8 (AK8), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AK8 (158067)
Length:
1490
CDS:
159..1376

Additional Resources:

NCBI RefSeq record:
XM_011518278.2
NBCI Gene record:
AK8 (158067)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149503 GTATCATAGGAACATCGTCA pXPR_003 GGG 457 38% 7 1.2644 AK8 AK8 77883
2 BRDN0001146232 TGAACGGGGCATTAGTACGA pXPR_003 TGG 563 46% 8 1.0703 AK8 AK8 77884
3 BRDN0001149279 TTCGGGTGGCCAGTCAAAGG pXPR_003 TGG 352 29% 7 0.6361 AK8 AK8 77882
4 BRDN0001148581 CTGGATGAGCTCGCCAAACG pXPR_003 TGG 715 59% 9 -0.0072 AK8 AK8 77885
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518278.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358967 CAAAGCAACCATCGTACTAAT pLKO_005 708 CDS 100% 13.200 18.480 N AK8 n/a
2 TRCN0000358966 CATCGAGAGTGGGATCATTAA pLKO_005 1331 CDS 100% 13.200 18.480 N AK8 n/a
3 TRCN0000078680 CCCTCAAACTGGAGAGATTTA pLKO.1 479 CDS 100% 13.200 9.240 N AK8 n/a
4 TRCN0000359047 TCACACCCAGACACGTCATTG pLKO_005 403 CDS 100% 10.800 7.560 N AK8 n/a
5 TRCN0000078682 CTGACTCTGAGAAGAATTGAT pLKO.1 1101 CDS 100% 5.625 3.938 N AK8 n/a
6 TRCN0000078678 GCTGACTTGGAGCAGTTGTAT pLKO.1 1257 CDS 100% 5.625 3.938 N AK8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518278.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05092 pDONR223 100% 84.5% 84.5% None 0_1ins222 n/a
2 ccsbBroad304_05092 pLX_304 0% 84.5% 84.5% V5 0_1ins222 n/a
3 ccsbBroadEn_15271 pDONR223 0% 84.5% 84.5% None 0_1ins222 n/a
4 ccsbBroad304_15271 pLX_304 0% 84.5% 84.5% V5 0_1ins222 n/a
5 TRCN0000480307 CCATCGTTTCGTGATACCTGTAGT pLX_317 30.2% 84.5% 84.5% V5 (not translated due to frame shift) 0_1ins222 n/a
Download CSV