Transcript: Human XM_011518284.2

PREDICTED: Homo sapiens tetratricopeptide repeat domain 16 (TTC16), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTC16 (158248)
Length:
2744
CDS:
83..2560

Additional Resources:

NCBI RefSeq record:
XM_011518284.2
NBCI Gene record:
TTC16 (158248)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518284.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127559 CTGAGGCTTTCTATGACTCAA pLKO.1 2352 CDS 100% 4.950 6.930 N TTC16 n/a
2 TRCN0000148326 CCTCAAAGTCAGGGAATACTA pLKO.1 256 CDS 100% 5.625 3.938 N TTC16 n/a
3 TRCN0000442085 CAACCGTGCCATCGAGAACAA pLKO_005 760 CDS 100% 4.950 3.465 N TTC16 n/a
4 TRCN0000131076 GCAGGAGAAAGGACTCTACAT pLKO.1 1024 CDS 100% 4.950 3.465 N TTC16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518284.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09720 pDONR223 100% 94.2% 94.1% None (many diffs) n/a
2 ccsbBroad304_09720 pLX_304 0% 94.2% 94.1% V5 (many diffs) n/a
3 TRCN0000478334 GTACTCCGTCTGACAGTATAAGGG pLX_317 8.9% 94.2% 94.1% V5 (many diffs) n/a
Download CSV