Transcript: Human XM_011518463.2

PREDICTED: Homo sapiens thioredoxin domain containing 8 (TXNDC8), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TXNDC8 (255220)
Length:
796
CDS:
92..409

Additional Resources:

NCBI RefSeq record:
XM_011518463.2
NBCI Gene record:
TXNDC8 (255220)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518463.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060033 CCATGCTATGTCTGTGAAATA pLKO.1 217 CDS 100% 13.200 9.240 N TXNDC8 n/a
2 TRCN0000060037 ACAAACTCGCAGTGGTTCAAT pLKO.1 150 CDS 100% 5.625 3.938 N TXNDC8 n/a
3 TRCN0000060036 GCTAATGTGGATGTGAACAAT pLKO.1 254 CDS 100% 5.625 3.938 N TXNDC8 n/a
4 TRCN0000060034 GCTGGCTGAAACTTGTCACAT pLKO.1 283 CDS 100% 4.950 3.465 N TXNDC8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518463.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05305 pDONR223 100% 82.6% 75.4% None (many diffs) n/a
2 ccsbBroad304_05305 pLX_304 0% 82.6% 75.4% V5 (many diffs) n/a
3 TRCN0000468930 CATCTGCCAGATGTTGCAATTGAT pLX_317 100% 82.6% 75.4% V5 (many diffs) n/a
Download CSV