Transcript: Human XM_011518475.3

PREDICTED: Homo sapiens MAM domain containing 2 (MAMDC2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAMDC2 (256691)
Length:
2990
CDS:
556..2211

Additional Resources:

NCBI RefSeq record:
XM_011518475.3
NBCI Gene record:
MAMDC2 (256691)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518475.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355760 CACTACAGGCTTAGGGTATTA pLKO_005 1680 CDS 100% 13.200 18.480 N MAMDC2 n/a
2 TRCN0000355761 TCCGTTTGGTCTACCAGATAA pLKO_005 797 CDS 100% 13.200 18.480 N MAMDC2 n/a
3 TRCN0000006974 CCCAATGTGAACTGGTTTGTT pLKO.1 1111 CDS 100% 5.625 4.500 N MAMDC2 n/a
4 TRCN0000006973 GCCCTGGATGACATTACAATA pLKO.1 2008 CDS 100% 13.200 9.240 N MAMDC2 n/a
5 TRCN0000006975 GCCATTACATTTATGTGGATA pLKO.1 704 CDS 100% 4.950 3.465 N MAMDC2 n/a
6 TRCN0000006976 GCAAGCTGAAATCACCTTTAA pLKO.1 1920 CDS 100% 13.200 7.920 N MAMDC2 n/a
7 TRCN0000117643 GTGCATCTCTTGCTGATATAA pLKO.1 2729 3UTR 100% 15.000 7.500 Y RPL24 n/a
8 TRCN0000300643 GTGCATCTCTTGCTGATATAA pLKO_005 2729 3UTR 100% 15.000 7.500 Y RPL24 n/a
9 TRCN0000104248 TGGTGCATCTCTTGCTGATAT pLKO.1 2727 3UTR 100% 13.200 6.600 Y Rpl24 n/a
10 TRCN0000117644 ACAAGCTATCAGGGCTGCTAA pLKO.1 2796 3UTR 100% 4.950 2.475 Y RPL24 n/a
11 TRCN0000300642 ACAAGCTATCAGGGCTGCTAA pLKO_005 2796 3UTR 100% 4.950 2.475 Y RPL24 n/a
12 TRCN0000104247 CTGGTGCATCTCTTGCTGATA pLKO.1 2726 3UTR 100% 4.950 2.475 Y Rpl24 n/a
13 TRCN0000104246 GCCAGGACCGACGGGAAGGTT pLKO.1 2542 3UTR 100% 0.000 0.000 Y Rpl24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518475.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13476 pDONR223 100% 14% 13.8% None (many diffs) n/a
2 ccsbBroad304_13476 pLX_304 0% 14% 13.8% V5 (many diffs) n/a
3 TRCN0000469617 ACGTTGTCTGCGCGAAAAAGGCGG pLX_317 48.7% 14% 13.8% V5 (many diffs) n/a
Download CSV