Transcript: Human XM_011518785.3

PREDICTED: Homo sapiens SHC adaptor protein 3 (SHC3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SHC3 (53358)
Length:
6055
CDS:
3943..5739

Additional Resources:

NCBI RefSeq record:
XM_011518785.3
NBCI Gene record:
SHC3 (53358)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518785.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116100 CTCCGGTTTAAGCAATATTTA pLKO.1 4849 CDS 100% 15.000 21.000 N SHC3 n/a
2 TRCN0000116098 GCTCCGGTTTAAGCAATATTT pLKO.1 4848 CDS 100% 15.000 21.000 N SHC3 n/a
3 TRCN0000230476 ATCGCAGAGCTTGTCACATTT pLKO_005 4769 CDS 100% 13.200 18.480 N SHC3 n/a
4 TRCN0000116097 GCTTCCTTTAAGGTCAAGTTT pLKO.1 5868 3UTR 100% 5.625 4.500 N SHC3 n/a
5 TRCN0000230477 AGCCTTTGAGCTCCGGTTTAA pLKO_005 4839 CDS 100% 13.200 9.240 N SHC3 n/a
6 TRCN0000230478 CATCAACCACCACCTAGAAAG pLKO_005 5652 CDS 100% 10.800 7.560 N SHC3 n/a
7 TRCN0000230479 CTTCCTTTAAGGTCAAGTTTC pLKO_005 5869 3UTR 100% 10.800 7.560 N SHC3 n/a
8 TRCN0000116101 CCTCTTTGACATGAAACCTTT pLKO.1 5301 CDS 100% 4.950 3.465 N SHC3 n/a
9 TRCN0000114699 CTGCGCTCAATGAGGTCTCTT pLKO.1 4438 CDS 100% 4.950 3.465 N Shc3 n/a
10 TRCN0000116099 GCATTGAAGTTCTGCGCTCAA pLKO.1 4427 CDS 100% 4.050 2.835 N SHC3 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 129 5UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 129 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518785.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.