Transcript: Human XM_011518803.2

PREDICTED: Homo sapiens AU RNA binding methylglutaconyl-CoA hydratase (AUH), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AUH (549)
Length:
620
CDS:
57..599

Additional Resources:

NCBI RefSeq record:
XM_011518803.2
NBCI Gene record:
AUH (549)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518803.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303618 AGTGAAGTCCCAGGGATATTC pLKO_005 477 CDS 100% 13.200 9.240 N AUH n/a
2 TRCN0000052452 GATAAGAAAGTACGGACCATA pLKO.1 447 CDS 100% 4.950 3.465 N AUH n/a
3 TRCN0000052449 GCTTGGAATAAACAGAGCTTA pLKO.1 359 CDS 100% 4.950 3.465 N AUH n/a
4 TRCN0000299346 GCTTGGAATAAACAGAGCTTA pLKO_005 359 CDS 100% 4.950 3.465 N AUH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518803.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10692 pDONR223 100% 50.9% 45.2% None (many diffs) n/a
2 ccsbBroad304_10692 pLX_304 0% 50.9% 45.2% V5 (many diffs) n/a
3 TRCN0000481053 CAATGATTCCATAACCTCATAGTC pLX_317 32% 50.9% 45.2% V5 (many diffs) n/a
Download CSV