Transcript: Human XM_011518880.1

PREDICTED: Homo sapiens potassium sodium-activated channel subfamily T member 1 (KCNT1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNT1 (57582)
Length:
4658
CDS:
1..3672

Additional Resources:

NCBI RefSeq record:
XM_011518880.1
NBCI Gene record:
KCNT1 (57582)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518880.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053644 CCTCAGCTACAAAGGCAACAT pLKO.1 489 CDS 100% 4.950 3.465 N KCNT1 n/a
2 TRCN0000053646 GCAAATTTAACAGCCAGTGAT pLKO.1 3412 CDS 100% 4.950 3.465 N KCNT1 n/a
3 TRCN0000053643 CCAGGACTATTACGTGGTCAT pLKO.1 1098 CDS 100% 4.050 2.835 N KCNT1 n/a
4 TRCN0000053645 CGGGTTCAAGAACAAGCTGAT pLKO.1 2289 CDS 100% 4.050 2.835 N KCNT1 n/a
5 TRCN0000053647 GCTGTTCAACTTCTCCCTGAA pLKO.1 249 CDS 100% 4.050 2.835 N KCNT1 n/a
6 TRCN0000421548 GCAACGAGGTGTACCACATTC pLKO_005 1574 CDS 100% 10.800 15.120 N Kcnt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518880.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.