Transcript: Human XM_011519000.2

PREDICTED: Homo sapiens SECIS binding protein 2 (SECISBP2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SECISBP2 (79048)
Length:
3893
CDS:
363..2723

Additional Resources:

NCBI RefSeq record:
XM_011519000.2
NBCI Gene record:
SECISBP2 (79048)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519000.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230346 AGAATAGAGACACCGAAATTT pLKO_005 1419 CDS 100% 15.000 21.000 N SECISBP2 n/a
2 TRCN0000230344 ACTCTGTCTCTACCGACATTT pLKO_005 895 CDS 100% 13.200 18.480 N SECISBP2 n/a
3 TRCN0000218104 AGCTAGAGGTTCACATCATTT pLKO_005 680 CDS 100% 13.200 18.480 N SECISBP2 n/a
4 TRCN0000230345 TGCTAATGCCGCTACCAATTC pLKO_005 1001 CDS 100% 10.800 8.640 N SECISBP2 n/a
5 TRCN0000135298 CGCAGTTTGAATAAGGCAGTT pLKO.1 2364 CDS 100% 4.050 3.240 N SECISBP2 n/a
6 TRCN0000133997 CAGAATAGAGACACCGAAATT pLKO.1 1418 CDS 100% 13.200 9.240 N SECISBP2 n/a
7 TRCN0000167679 GCCTCAAGAAAGAATAAGAAA pLKO.1 1287 CDS 100% 5.625 3.375 N SECISBP2 n/a
8 TRCN0000253077 TTGGACACCAATGGGTTATAT pLKO_005 1046 CDS 100% 15.000 10.500 N Secisbp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519000.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000466797 GGACAAAGAGTTCTATCACCGTCA pLX_317 15.2% 91.9% 91.9% V5 0_1ins204;1278A>G;1453A>G n/a
Download CSV