Transcript: Human XM_011519004.1

PREDICTED: Homo sapiens chromosome 9 open reading frame 16 (C9orf16), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C9orf16 (79095)
Length:
659
CDS:
16..348

Additional Resources:

NCBI RefSeq record:
XM_011519004.1
NBCI Gene record:
C9orf16 (79095)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519004.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263835 GATCAACTCCTGTCTGGACCA pLKO_005 207 CDS 100% 2.160 1.728 N C9orf16 n/a
2 TRCN0000263836 CTGGCTTAGACACCTTCTCAA pLKO_005 419 3UTR 100% 4.950 3.465 N C9orf16 n/a
3 TRCN0000263837 TCCATGCTGGACCAGATCAAC pLKO_005 193 CDS 100% 4.950 3.465 N C9orf16 n/a
4 TRCN0000263834 CTGGAGGAGAAGAATGACCAC pLKO_005 229 CDS 100% 2.160 1.296 N C9orf16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519004.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04048 pDONR223 100% 62.5% 60.9% None (many diffs) n/a
2 ccsbBroad304_04048 pLX_304 0% 62.5% 60.9% V5 (many diffs) n/a
3 TRCN0000475190 TGTCCCCTCAAAAGGAAGTCTGAT pLX_317 100% 62.5% 60.9% V5 (many diffs) n/a
Download CSV