Transcript: Human XM_011519351.2

PREDICTED: Homo sapiens armadillo repeat containing 3 (ARMC3), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARMC3 (219681)
Length:
2581
CDS:
187..1533

Additional Resources:

NCBI RefSeq record:
XM_011519351.2
NBCI Gene record:
ARMC3 (219681)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519351.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422068 TATGATTATGGTCGGATAAAT pLKO_005 631 CDS 100% 15.000 21.000 N ARMC3 n/a
2 TRCN0000165876 GCCCGGACTGAGTTAAGAAAT pLKO.1 328 CDS 100% 13.200 18.480 N ARMC3 n/a
3 TRCN0000433672 GTTGGTTATGGACGAAGTATT pLKO_005 778 CDS 100% 13.200 10.560 N ARMC3 n/a
4 TRCN0000165141 GCTCCTGAGATGTACGTGATT pLKO.1 1441 CDS 100% 4.950 3.960 N ARMC3 n/a
5 TRCN0000434583 TACTGCCAATAACCAATATTA pLKO_005 1115 CDS 100% 15.000 10.500 N ARMC3 n/a
6 TRCN0000160546 CTGATGGTATTGATCCATTAA pLKO.1 104 5UTR 100% 13.200 9.240 N ARMC3 n/a
7 TRCN0000160619 CACCTTCATCTATGGAAGATA pLKO.1 749 CDS 100% 5.625 3.938 N ARMC3 n/a
8 TRCN0000159654 GCTGATCTTTACAGATTCATT pLKO.1 1510 CDS 100% 5.625 3.375 N ARMC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519351.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09843 pDONR223 100% 51.3% 51.2% None 0_1ins1272;605G>A n/a
2 ccsbBroad304_09843 pLX_304 0% 51.3% 51.2% V5 0_1ins1272;605G>A n/a
3 TRCN0000470583 TCGGTCATTCCGGCTCTTCTCATG pLX_317 18.2% 51.3% 51.2% V5 0_1ins1272;605G>A n/a
Download CSV