Transcript: Human XM_011519555.3

PREDICTED: Homo sapiens KIAA1217 (KIAA1217), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIAA1217 (56243)
Length:
6209
CDS:
237..6209

Additional Resources:

NCBI RefSeq record:
XM_011519555.3
NBCI Gene record:
KIAA1217 (56243)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519555.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434223 GATCCTGCACATGCGTTTAAT pLKO_005 1170 CDS 100% 15.000 21.000 N KIAA1217 n/a
2 TRCN0000438701 ATCGCCCAGTGTCGCCATTTA pLKO_005 1061 CDS 100% 13.200 18.480 N KIAA1217 n/a
3 TRCN0000122815 GCTAAGGCAAGCAGTGAAGAT pLKO.1 3618 CDS 100% 4.950 6.930 N KIAA1217 n/a
4 TRCN0000121659 GTACGGAAATCTGATGTTGAA pLKO.1 3936 CDS 100% 4.950 6.930 N KIAA1217 n/a
5 TRCN0000122253 CAGAGCTTGTTCATTGAAGAA pLKO.1 3213 CDS 100% 4.950 3.960 N KIAA1217 n/a
6 TRCN0000143760 CCTCTAATGGAGAAGCAAGTT pLKO.1 1992 CDS 100% 4.950 3.960 N KIAA1217 n/a
7 TRCN0000441566 GACATCCGGTCTGCCTATAAG pLKO_005 4731 CDS 100% 13.200 9.240 N KIAA1217 n/a
8 TRCN0000145223 GAAAGGAGAATTTCCAACCTT pLKO.1 2681 CDS 100% 3.000 2.100 N KIAA1217 n/a
9 TRCN0000142602 GCACAGTACATGGCTATGGAA pLKO.1 2880 CDS 100% 3.000 2.100 N KIAA1217 n/a
10 TRCN0000144062 CGGAAATGCATATGGAACAAT pLKO.1 1702 CDS 100% 0.000 0.000 N KIAA1217 n/a
11 TRCN0000143347 GATGAAGACATGAGTGGCAAA pLKO.1 1503 CDS 100% 4.050 2.430 N KIAA1217 n/a
12 TRCN0000190517 GAGGAGGAAGAAGAAGAAGAA pLKO.1 3744 CDS 100% 4.950 2.475 Y G430095P16Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519555.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12297 pDONR223 100% 43.3% 42.4% None (many diffs) n/a
2 ccsbBroad304_12297 pLX_304 0% 43.3% 42.4% V5 (many diffs) n/a
Download CSV