Transcript: Human XM_011519854.1

PREDICTED: Homo sapiens CUGBP Elav-like family member 1 (CELF1), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CELF1 (10658)
Length:
8295
CDS:
539..2002

Additional Resources:

NCBI RefSeq record:
XM_011519854.1
NBCI Gene record:
CELF1 (10658)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519854.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233074 TACTCGGGTATCCAGCAATAT pLKO_005 1628 CDS 100% 13.200 18.480 N CELF1 n/a
2 TRCN0000221656 CGAGTCATGTTCTCTTCGTTT pLKO.1 911 CDS 100% 4.950 3.960 N CELF1 n/a
3 TRCN0000233072 AGCTGTTTATTGGTATGATTT pLKO_005 864 CDS 100% 13.200 9.240 N CELF1 n/a
4 TRCN0000233075 ATTGGCATGAAGCGGCTTAAA pLKO_005 1940 CDS 100% 13.200 9.240 N CELF1 n/a
5 TRCN0000221657 CCTAGCTCTAGCAGCAGTAAT pLKO.1 1442 CDS 100% 13.200 9.240 N CELF1 n/a
6 TRCN0000233073 GATTGAAGAATGCCGGATATT pLKO_005 937 CDS 100% 13.200 9.240 N CELF1 n/a
7 TRCN0000098510 CGTCAAGTACATCGTCCAAAT pLKO.1 5387 3UTR 100% 10.800 7.560 N Celf1 n/a
8 TRCN0000233076 CGTCAAGTACATCGTCCAAAT pLKO_005 5387 3UTR 100% 10.800 7.560 N CELF1 n/a
9 TRCN0000326898 CGTCAAGTACATCGTCCAAAT pLKO_005 5387 3UTR 100% 10.800 7.560 N Celf1 n/a
10 TRCN0000221654 CGGCTTAAAGTGCAGCTCAAA pLKO.1 1952 CDS 100% 4.950 3.465 N CELF1 n/a
11 TRCN0000221655 GCTGCATTAGAAGCTCAGAAT pLKO.1 749 CDS 100% 4.950 3.465 N CELF1 n/a
12 TRCN0000221658 CTTGATGCTATCAAGATGTTT pLKO.1 575 CDS 100% 0.563 0.394 N CELF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519854.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.