Transcript: Human XM_011519960.3

PREDICTED: Homo sapiens mitochondrial carrier 2 (MTCH2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTCH2 (23788)
Length:
2813
CDS:
70..966

Additional Resources:

NCBI RefSeq record:
XM_011519960.3
NBCI Gene record:
MTCH2 (23788)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519960.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059393 CCTCCAACAATAGGACGAAAT pLKO.1 175 CDS 100% 10.800 15.120 N MTCH2 n/a
2 TRCN0000059397 GCCTACCTCGTCAATACCTAT pLKO.1 640 CDS 100% 4.950 6.930 N MTCH2 n/a
3 TRCN0000286609 GCCTACCTCGTCAATACCTAT pLKO_005 640 CDS 100% 4.950 6.930 N MTCH2 n/a
4 TRCN0000114240 TCCTCCAACAATAGGACGAAA pLKO.1 174 CDS 100% 4.950 6.930 N Mtch2 n/a
5 TRCN0000059396 CCCAATATATACGTCTTGGAT pLKO.1 819 CDS 100% 3.000 4.200 N MTCH2 n/a
6 TRCN0000295556 AGCCGCTCATGTACGTGAAAG pLKO_005 125 CDS 100% 10.800 7.560 N Mtch2 n/a
7 TRCN0000059395 CCCTTTGTGCTTGTCTCCAAT pLKO.1 748 CDS 100% 4.950 3.465 N MTCH2 n/a
8 TRCN0000286673 CCCTTTGTGCTTGTCTCCAAT pLKO_005 748 CDS 100% 4.950 3.465 N MTCH2 n/a
9 TRCN0000059394 GCCTTCTAGGTGACATCCTTT pLKO.1 596 CDS 100% 4.950 3.465 N MTCH2 n/a
10 TRCN0000286674 GCCTTCTAGGTGACATCCTTT pLKO_005 596 CDS 100% 4.950 3.465 N MTCH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519960.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02842 pDONR223 100% 86.4% 86.6% None (many diffs) n/a
2 ccsbBroad304_02842 pLX_304 0% 86.4% 86.6% V5 (many diffs) n/a
3 TRCN0000479897 AATCAAGAAGGGCGTCCGCATTCG pLX_317 39.1% 86.4% 86.6% V5 (many diffs) n/a
Download CSV