Transcript: Human XM_011520074.3

PREDICTED: Homo sapiens natural killer cell cytotoxicity receptor 3 ligand 1 (NCR3LG1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NCR3LG1 (374383)
Length:
5204
CDS:
396..1673

Additional Resources:

NCBI RefSeq record:
XM_011520074.3
NBCI Gene record:
NCR3LG1 (374383)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520074.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144511 CCTGAGGGAAGTGTTAATATT pLKO.1 1323 CDS 100% 15.000 21.000 N NCR3LG1 n/a
2 TRCN0000140049 CGGCACAGTCTTTCTGAAACT pLKO.1 1053 CDS 100% 4.950 3.960 N NCR3LG1 n/a
3 TRCN0000138996 CTGGATCAAGTGGGCATGAAA pLKO.1 753 CDS 100% 5.625 3.938 N NCR3LG1 n/a
4 TRCN0000141419 CTGAAGAAAGAGCACCTCATA pLKO.1 1245 CDS 100% 4.950 3.465 N NCR3LG1 n/a
5 TRCN0000142091 GCTCTCCTAACAGTTACATCA pLKO.1 1470 CDS 100% 4.950 3.465 N NCR3LG1 n/a
6 TRCN0000141479 CCATCCCATAGAGATTTCTGA pLKO.1 863 CDS 100% 3.000 2.100 N NCR3LG1 n/a
7 TRCN0000139616 CCCTGAATGACAATGTCACCA pLKO.1 424 CDS 100% 2.640 1.584 N NCR3LG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520074.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05533 pDONR223 100% 93.6% 93.6% None 0_1ins87 n/a
2 ccsbBroad304_05533 pLX_304 0% 93.6% 93.6% V5 0_1ins87 n/a
3 TRCN0000477879 TGACCAATGGCAGAGCTTCAACCA pLX_317 20.1% 93.6% 93.6% V5 0_1ins87 n/a
Download CSV