Transcript: Human XM_011520219.2

PREDICTED: Homo sapiens matrix metallopeptidase 26 (MMP26), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MMP26 (56547)
Length:
1174
CDS:
412..987

Additional Resources:

NCBI RefSeq record:
XM_011520219.2
NBCI Gene record:
MMP26 (56547)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520219.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051422 CCTGCAACAATTCCATCGGAA pLKO.1 372 5UTR 100% 2.640 3.696 N MMP26 n/a
2 TRCN0000051418 CCGCAGTGAAAGACAGTATAT pLKO.1 554 CDS 100% 13.200 10.560 N MMP26 n/a
3 TRCN0000434059 TGTCCTTTCAGGGAGTTTATT pLKO_005 1014 3UTR 100% 15.000 10.500 N MMP26 n/a
4 TRCN0000434750 GTTCATCTGACATACCTTAAT pLKO_005 968 CDS 100% 13.200 9.240 N MMP26 n/a
5 TRCN0000051421 CCTGGTTGCAACTCATGAGAT pLKO.1 810 CDS 100% 4.950 3.465 N MMP26 n/a
6 TRCN0000051419 GCACACTCTAACTTACAGGAT pLKO.1 504 CDS 100% 2.640 1.848 N MMP26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520219.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03726 pDONR223 100% 73.1% 73.1% None 0_1ins210 n/a
2 ccsbBroad304_03726 pLX_304 0% 73.1% 73.1% V5 0_1ins210 n/a
Download CSV