Transcript: Human XM_011520300.2

PREDICTED: Homo sapiens chitinase domain containing 1 (CHID1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHID1 (66005)
Length:
1634
CDS:
195..1538

Additional Resources:

NCBI RefSeq record:
XM_011520300.2
NBCI Gene record:
CHID1 (66005)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520300.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422210 TCATGACCTACGACTACTCTA pLKO_005 1129 CDS 100% 4.950 6.930 N CHID1 n/a
2 TRCN0000050757 CAACTTCTATGGTATGGACTA pLKO.1 1253 CDS 100% 4.050 5.670 N CHID1 n/a
3 TRCN0000050756 CTACGATGTCACCAAGGTCTT pLKO.1 725 CDS 100% 4.050 5.670 N CHID1 n/a
4 TRCN0000050755 GCACTTCTTCGAGTACAAGAA pLKO.1 1376 CDS 100% 0.495 0.396 N CHID1 n/a
5 TRCN0000371788 GGACTGGACTTACGATGATTT pLKO_005 908 CDS 100% 13.200 9.240 N CHID1 n/a
6 TRCN0000371743 TGTTCACGCACAAGGAGTTTG pLKO_005 1075 CDS 100% 10.800 7.560 N CHID1 n/a
7 TRCN0000050753 GCAAAGAACCAGCATTTCGAT pLKO.1 990 CDS 100% 3.000 2.100 N CHID1 n/a
8 TRCN0000050754 CCTGTCAAAGTCAGATGCCAA pLKO.1 509 CDS 100% 2.640 1.848 N CHID1 n/a
9 TRCN0000198792 CAAGGTCTTTGGGAGCAAGTT pLKO.1 737 CDS 100% 4.950 2.970 N Chid1 n/a
10 TRCN0000276837 CAAGGTCTTTGGGAGCAAGTT pLKO_005 737 CDS 100% 4.950 2.970 N Chid1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520300.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04009 pDONR223 100% 75.7% 75.7% None 1_255del;863_864ins93 n/a
2 ccsbBroad304_04009 pLX_304 0% 75.7% 75.7% V5 1_255del;863_864ins93 n/a
3 TRCN0000469757 TTAAGGTCAGACGTTCGTGTGGAT pLX_317 29.1% 75.7% 75.7% V5 1_255del;863_864ins93 n/a
Download CSV