Transcript: Human XM_011520320.1

PREDICTED: Homo sapiens DENN domain containing 2B (DENND2B), transcript variant X24, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DENND2B (6764)
Length:
3078
CDS:
12..2945

Additional Resources:

NCBI RefSeq record:
XM_011520320.1
NBCI Gene record:
DENND2B (6764)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520320.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038041 GCTTCGGTTATTTGGACAGAA pLKO.1 394 CDS 100% 4.950 6.930 N DENND2B n/a
2 TRCN0000413609 ATATGAGGATGTGGACTTAAA pLKO_005 1601 CDS 100% 13.200 9.240 N DENND2B n/a
3 TRCN0000038039 CCCAAGAGTAAGCCCAGTAAT pLKO.1 1305 CDS 100% 13.200 9.240 N DENND2B n/a
4 TRCN0000419002 GTCTATGTCCAGCATTGAAAC pLKO_005 2009 CDS 100% 10.800 7.560 N DENND2B n/a
5 TRCN0000038043 CCAAAGAATTAACTCCATCTA pLKO.1 1952 CDS 100% 4.950 3.465 N DENND2B n/a
6 TRCN0000038042 CGCTGCATTGGTCTATCCTTT pLKO.1 2627 CDS 100% 4.950 3.465 N DENND2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520320.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07005 pDONR223 100% 77.5% 76.4% None (many diffs) n/a
2 ccsbBroad304_07005 pLX_304 0% 77.5% 76.4% V5 (many diffs) n/a
3 TRCN0000492045 ACAGCCTGGCCCTACACCTATTGT pLX_317 8.5% 77.5% 76.4% V5 (many diffs) n/a
Download CSV