Transcript: Human XM_011520566.2

PREDICTED: Homo sapiens alpha-2-macroglobulin like 1 (A2ML1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
A2ML1 (144568)
Length:
5241
CDS:
99..4502

Additional Resources:

NCBI RefSeq record:
XM_011520566.2
NBCI Gene record:
A2ML1 (144568)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520566.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073655 GCAGACGGTGTTGAGATACAA pLKO.1 4067 CDS 100% 5.625 4.500 N A2ML1 n/a
2 TRCN0000442764 CAGTTAACAGATTGGTATTTC pLKO_005 3976 CDS 100% 13.200 9.240 N A2ML1 n/a
3 TRCN0000073656 CTCACTATTCACACCAGTTAT pLKO.1 4182 CDS 100% 13.200 9.240 N A2ML1 n/a
4 TRCN0000073654 GCAACAATTCAGTATTCTGAT pLKO.1 4470 CDS 100% 4.950 3.465 N A2ML1 n/a
5 TRCN0000073657 CCTGGTGAAGAAGGTTGAATT pLKO.1 4304 CDS 100% 0.000 0.000 N A2ML1 n/a
6 TRCN0000256745 CAGCCTGGCCAACATGGTAAA pLKO_005 4923 3UTR 100% 10.800 5.400 Y SMIM11A n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4857 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 4896 3UTR 100% 4.050 2.025 Y P3H4 n/a
9 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 4896 3UTR 100% 4.050 2.025 Y ORAI2 n/a
10 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 4896 3UTR 100% 4.050 2.025 Y P3H4 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4858 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520566.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.