Transcript: Human XM_011520760.2

PREDICTED: Homo sapiens forkhead box J2 (FOXJ2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FOXJ2 (55810)
Length:
5656
CDS:
1169..2944

Additional Resources:

NCBI RefSeq record:
XM_011520760.2
NBCI Gene record:
FOXJ2 (55810)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520760.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338507 CCCGTCTGTATATAGACATAT pLKO_005 3070 3UTR 100% 13.200 18.480 N FOXJ2 n/a
2 TRCN0000021083 CGAGCTACCATTGAGAAGCTT pLKO.1 1229 CDS 100% 3.000 2.400 N FOXJ2 n/a
3 TRCN0000021079 CCGCTGGATCTGTGATAACTT pLKO.1 1447 CDS 100% 5.625 3.938 N FOXJ2 n/a
4 TRCN0000338438 CCGCTGGATCTGTGATAACTT pLKO_005 1447 CDS 100% 5.625 3.938 N FOXJ2 n/a
5 TRCN0000084288 CCACCCATAATGCTTTGCATT pLKO.1 5531 3UTR 100% 4.950 3.465 N Foxj2 n/a
6 TRCN0000021082 GTCACAATTCTCAGAACTGAT pLKO.1 2482 CDS 100% 4.950 3.465 N FOXJ2 n/a
7 TRCN0000338506 GTCACAATTCTCAGAACTGAT pLKO_005 2482 CDS 100% 4.950 3.465 N FOXJ2 n/a
8 TRCN0000021080 CCCATCACCAATGTACCCAAT pLKO.1 2840 CDS 100% 4.050 2.835 N FOXJ2 n/a
9 TRCN0000021081 CCGCAACCTCTATAAGTCCAT pLKO.1 1933 CDS 100% 2.640 1.848 N FOXJ2 n/a
10 TRCN0000338439 CCGCAACCTCTATAAGTCCAT pLKO_005 1933 CDS 100% 2.640 1.848 N FOXJ2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520760.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03659 pDONR223 100% 92.7% 87.3% None 1537_1627del;1773_1774ins40 n/a
2 ccsbBroad304_03659 pLX_304 0% 92.7% 87.3% V5 1537_1627del;1773_1774ins40 n/a
3 TRCN0000474644 GGTAGCAAGTGCAGTCAGCTCCGG pLX_317 18.6% 92.7% 87.3% V5 1537_1627del;1773_1774ins40 n/a
Download CSV