Transcript: Human XM_011520973.2

PREDICTED: Homo sapiens poly(ADP-ribose) polymerase family member 11 (PARP11), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PARP11 (57097)
Length:
1221
CDS:
70..1065

Additional Resources:

NCBI RefSeq record:
XM_011520973.2
NBCI Gene record:
PARP11 (57097)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011520973.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432073 ACTGGAAAGCAGCGCTTAATA pLKO_005 340 CDS 100% 15.000 21.000 N PARP11 n/a
2 TRCN0000418657 ATGGATCGCAACCGAATTAAA pLKO_005 529 CDS 100% 15.000 21.000 N PARP11 n/a
3 TRCN0000004535 GACGGGAGCTATGTGAATTTA pLKO.1 949 CDS 100% 15.000 21.000 N PARP11 n/a
4 TRCN0000426121 TGCTAATTGGAGATTACATAA pLKO_005 893 CDS 100% 13.200 18.480 N PARP11 n/a
5 TRCN0000418181 CCAAATTCAGCTACAAGATAG pLKO_005 287 CDS 100% 10.800 15.120 N PARP11 n/a
6 TRCN0000421274 GTGAATACTCAAGTACCATAT pLKO_005 442 CDS 100% 10.800 15.120 N PARP11 n/a
7 TRCN0000425432 TGACATGGACACGTCAGATAC pLKO_005 123 CDS 100% 10.800 8.640 N PARP11 n/a
8 TRCN0000004536 CCAAATACATGCGACCTCCTT pLKO.1 923 CDS 100% 2.640 2.112 N PARP11 n/a
9 TRCN0000413777 GCATCTGTTTAGAACATATAA pLKO_005 852 CDS 100% 15.000 10.500 N PARP11 n/a
10 TRCN0000191426 CAAGATAGACTTTGCAGAAAT pLKO.1 300 CDS 100% 13.200 9.240 N Parp11 n/a
11 TRCN0000435806 GCCTCAGATTAATGAACAAAT pLKO_005 630 CDS 100% 13.200 9.240 N PARP11 n/a
12 TRCN0000435964 ATGAAGTTGCTAATCTCTTTG pLKO_005 500 CDS 100% 10.800 7.560 N PARP11 n/a
13 TRCN0000004537 CAACCAAATCTATCCTGAGTA pLKO.1 1026 CDS 100% 4.950 3.465 N PARP11 n/a
14 TRCN0000004538 CCTCTGCACAATCAAACACAT pLKO.1 472 CDS 100% 4.950 3.465 N PARP11 n/a
15 TRCN0000010887 TCTCGGTGGTCAAGGAAGCTT pLKO.1 1079 3UTR 100% 3.000 2.100 N PARP11 n/a
16 TRCN0000417962 CAATCTGCATTCATAACTTTG pLKO_005 686 CDS 100% 10.800 6.480 N PARP11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011520973.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12328 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12328 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474635 CCTCCCTCAACGAGCTCCTTGCTG pLX_317 53.1% 100% 100% V5 n/a
4 ccsbBroadEn_12329 pDONR223 100% 69.4% 68.2% None (many diffs) n/a
5 ccsbBroad304_12329 pLX_304 0% 69.4% 68.2% V5 (many diffs) n/a
6 TRCN0000468259 CCGAAACAACATAGTAGAGACCCA pLX_317 60% 69.4% 68.2% V5 (many diffs) n/a
Download CSV