Transcript: Human XM_011521089.2

PREDICTED: Homo sapiens importin 5 (IPO5), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IPO5 (3843)
Length:
6199
CDS:
395..3742

Additional Resources:

NCBI RefSeq record:
XM_011521089.2
NBCI Gene record:
IPO5 (3843)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521089.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152684 GCGGATTCTAAGACCAAAGAA pLKO.1 3320 CDS 100% 5.625 7.875 N IPO5 n/a
2 TRCN0000155869 CCATCACTGAAGCACATCGTT pLKO.1 2054 CDS 100% 3.000 4.200 N IPO5 n/a
3 TRCN0000151824 CCAGACAGACTTCAATGATAT pLKO.1 2209 CDS 100% 13.200 9.240 N IPO5 n/a
4 TRCN0000152127 CCAATATTGTTGCACAGACTA pLKO.1 1341 CDS 100% 4.950 3.465 N IPO5 n/a
5 TRCN0000150776 GATTGCAGATACTGTTCCAAA pLKO.1 1174 CDS 100% 4.950 3.465 N IPO5 n/a
6 TRCN0000153065 GCTTCAATTAAGCCCGAAGTA pLKO.1 2348 CDS 100% 4.950 3.465 N IPO5 n/a
7 TRCN0000150535 GCCTCATTTAAATACGCAGAA pLKO.1 3140 CDS 100% 4.050 2.835 N IPO5 n/a
8 TRCN0000153401 GCCATCAGAAATACAACAGCT pLKO.1 590 CDS 100% 2.640 1.848 N IPO5 n/a
9 TRCN0000151217 GCATTCCATTATGGTACTGAA pLKO.1 1915 CDS 100% 4.950 2.970 N IPO5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521089.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10938 pDONR223 100% 98.3% 98.3% None 1_54del n/a
2 ccsbBroad304_10938 pLX_304 0% 98.3% 98.3% V5 1_54del n/a
3 TRCN0000478234 TATAAATTTGACGCGGACTCTGGC pLX_317 9.8% 98.3% 98.3% V5 1_54del n/a
Download CSV