Transcript: Human XM_011521456.2

PREDICTED: Homo sapiens solute carrier organic anion transporter family member 3A1 (SLCO3A1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLCO3A1 (28232)
Length:
2544
CDS:
176..2134

Additional Resources:

NCBI RefSeq record:
XM_011521456.2
NBCI Gene record:
SLCO3A1 (28232)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521456.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296797 TTAGTAATCCAAGGGTCATTT pLKO_005 2161 3UTR 100% 13.200 18.480 N SLCO3A1 n/a
2 TRCN0000079257 GCGGTCTTCATTGACACAAGT pLKO.1 728 CDS 100% 4.950 6.930 N Slco3a1 n/a
3 TRCN0000043265 CCAGACACATAGGACAAAGTT pLKO.1 2059 CDS 100% 5.625 4.500 N SLCO3A1 n/a
4 TRCN0000291269 CCAGACACATAGGACAAAGTT pLKO_005 2059 CDS 100% 5.625 4.500 N SLCO3A1 n/a
5 TRCN0000043264 CGGTCTTCATTGACACAAGTA pLKO.1 729 CDS 100% 4.950 3.960 N SLCO3A1 n/a
6 TRCN0000307638 CGGTCTTCATTGACACAAGTA pLKO_005 729 CDS 100% 4.950 3.960 N SLCO3A1 n/a
7 TRCN0000296814 TGTTCACGATGCTGGTATTTG pLKO_005 654 CDS 100% 13.200 9.240 N SLCO3A1 n/a
8 TRCN0000043263 CCTGCAATAATAACTGTGAAT pLKO.1 1410 CDS 100% 4.950 3.465 N SLCO3A1 n/a
9 TRCN0000043267 CTGGGCTCTTTCTGTACCAAA pLKO.1 695 CDS 100% 4.950 3.465 N SLCO3A1 n/a
10 TRCN0000043266 GCTCAAATCCTTCGCCTTCAT pLKO.1 1897 CDS 100% 4.950 3.465 N SLCO3A1 n/a
11 TRCN0000291270 GCTCAAATCCTTCGCCTTCAT pLKO_005 1897 CDS 100% 4.950 3.465 N SLCO3A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521456.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08091 pDONR223 100% 87.2% 85.4% None (many diffs) n/a
2 ccsbBroad304_08091 pLX_304 0% 87.2% 85.4% V5 (many diffs) n/a
3 TRCN0000477005 GATGTGAAGCCACAGACAAATGGC pLX_317 16.7% 87.2% 85.4% V5 (many diffs) n/a
Download CSV