Construct: ORF TRCN0000477005
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010920.1_s317c1
- Derived from:
- ccsbBroadEn_08091
- DNA Barcode:
- GATGTGAAGCCACAGACAAATGGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SLCO3A1 (28232)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477005
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 28232 | SLCO3A1 | solute carrier organic anio... | NM_001145044.1 | 99.8% | 99.7% | (many diffs) |
| 2 | human | 28232 | SLCO3A1 | solute carrier organic anio... | XM_005254889.1 | 96.7% | 94.9% | (many diffs) |
| 3 | human | 28232 | SLCO3A1 | solute carrier organic anio... | NM_013272.4 | 95.6% | 93.9% | (many diffs) |
| 4 | human | 28232 | SLCO3A1 | solute carrier organic anio... | XM_011521456.2 | 87.2% | 85.4% | (many diffs) |
| 5 | human | 28232 | SLCO3A1 | solute carrier organic anio... | NR_135775.2 | 82.2% | (many diffs) | |
| 6 | human | 28232 | SLCO3A1 | solute carrier organic anio... | XM_005254891.3 | 79.5% | 77.7% | (many diffs) |
| 7 | human | 28232 | SLCO3A1 | solute carrier organic anio... | XR_931796.2 | 73.3% | (many diffs) | |
| 8 | human | 28232 | SLCO3A1 | solute carrier organic anio... | XR_931795.1 | 39.9% | (many diffs) | |
| 9 | mouse | 108116 | Slco3a1 | solute carrier organic anio... | NM_001038643.1 | 90.6% | 97.8% | (many diffs) |
| 10 | mouse | 108116 | Slco3a1 | solute carrier organic anio... | NM_023908.2 | 87% | 92.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2142
- ORF length:
- 2076
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca ggggaagaag ccgggcggtt cgtcgggcgg cggccggagc ggcgagctgc 121 agggggacga ggcgcagagg aacaagaaaa agaaaaagaa ggtgtcctgc ttttccaaca 181 tcaagatctt ccttgtgtcc gagtgcgccc tgatgctggc gcagggcacg gtgggcgcct 241 acctggtgag cgtcctgacc accctggagc gtaggttcaa cctgcagagc gctgacgtgg 301 gtgtgatcgc tagcagcttc gagatcggga acctggcgct catcctcttc gtgagctact 361 tcggggcacg cgggcaccgg ccgcgcctga tcggctgcgg cggcatcgtc atggcgctgg 421 gcgcgctgct gtcggcgctg cccgagttcc tgacccacca gtacaagtac gaggcgggcg 481 agatccgctg gggcgccgag ggccgcgacg tctgcgcagc caacggctcg ggcggcgacg 541 aggggcccga ccccgacctc atctgcctca accggacggc taccaacatg atgtacttgc 601 tgctcattgg ggcccaggtg ctcctgggca tcggtgctac ccctgtgcag cccctgggcg 661 tctcctacat cgacgaccac gtgcggagga aggactcctc gctctatata ggaatcctgt 721 tcacgatgct ggtatttgga ccagcctgcg ggtttatcct gggctctttc tgtaccaaaa 781 tctacgtgga tgcagtcttc attgacacaa gtaacctgga catcactccg gacgaccccc 841 gctggatcgg agcctggtgg ggtggctttc tgctctgcgg tgccttactc ttcttctctt 901 ccctcttgat gtttgggttt ccacagtccc tgcccccgca ctcagacccc gccatggaaa 961 gcgagcaggc catgctctcc gaaagagaat acgagagacc caagcccagc aacggggtcc 1021 tgaggcaccc cctggagcca gacagcagtg cctcctgttt ccagcagctg agagtgatcc 1081 cgaaggtcac caagcacctg ctctcaaacc ctgtgttcac ctgcatcatc ctggccgcct 1141 gcatggagat tgcagtggtg gctggcttcg ctgccttttt ggggaagtac ctggagcagc 1201 agtttaacct caccacctct tctgccaacc agctgcttgg gatgactgcg atcccgtgtg 1261 cttgtctggg tatcttcctg ggaggtcttt tggtgaagaa gctcagcctg tctgccctgg 1321 gggccattcg gatggccatg ctcgtcaacc tggtgtccac tgcttgctac gtctccttcc 1381 tcttcctggg ctgcgacact ggccctgtgg ctggggttac tgttccctat ggaaacagca 1441 cagcacctgg ctcagccctg gacccctact cgccctgcaa taataactgt gaatgccaaa 1501 ccgattcctt cactccagtg tgtggggcag atggcatcac ctacctgtct gcctgctttg 1561 ctggctgcaa cagcacgaat ctcacgggct gtgcgtgcct caccaccgtc cctgctgaga 1621 acgcaaccgt ggttcctgga aaatgcccca gtcctgggtg ccaagaggcc ttcctcactt 1681 tcctctgtgt gatgtgtatc tgcagcctga tcggtgccat ggcacagaca ccctcagtca 1741 tcatcctcat caggacagtc agccctgaac tcaagtctta cgctttggga gttctttttc 1801 TCCTCCTTCG TTTGTTGGGC TTCATCCCTC CACCCCTCAT CTTCGGGGCT GGCATCGACT 1861 CCACCTGCCT GTTCTGGAGC ACGTTCTGTG GGGAGCAAGG CGCCTGCGTC CTCTACGACA 1921 ATGTGGTCTA CCGATACCTG TATGTCAGCA TCGCCATCGC GCTCAAATCC TTCGCCTTCA 1981 TCCTGTACAC CACCACGTGG CAGTGCCTGA GGAAAAACTA TAAACGCTAC ATCAAAAACC 2041 ACGAGGGCGG GCTGAGCACC AGCACAGAGT ACCAAGACAT TGAGACTGAG AAAACCTGCC 2101 CCGAATCACA TTCACCTTCA GAAGACTCCT TTGTGAGAAG CTGCCCAACT TTCTTGTACA 2161 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 2221 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 2281 AGGACGAGAT GTGAAGCCAC AGACAAATGG CACGCGTTAA GTCgacaatc aacctctgga 2341 ttacaaaatt tgtgaaagat t