Transcript: Human XM_011521686.3

PREDICTED: Homo sapiens INO80 complex ATPase subunit (INO80), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
INO80 (54617)
Length:
4113
CDS:
79..2799

Additional Resources:

NCBI RefSeq record:
XM_011521686.3
NBCI Gene record:
INO80 (54617)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521686.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365462 TGTAATCACCCGGAGTTATTT pLKO_005 574 CDS 100% 15.000 21.000 N INO80 n/a
2 TRCN0000370591 CCCTAAAGCCATACCACATTT pLKO_005 629 CDS 100% 13.200 18.480 N INO80 n/a
3 TRCN0000365461 TACGGGTACAACGTGTCTAAA pLKO_005 2560 CDS 100% 13.200 18.480 N INO80 n/a
4 TRCN0000365523 GCTAGTAAGGGAGATTGTATA pLKO_005 3235 3UTR 100% 13.200 9.240 N INO80 n/a
5 TRCN0000107557 GCTGCTATATCAGGCACTAAA pLKO.1 444 CDS 100% 13.200 9.240 N INO80 n/a
6 TRCN0000107555 GCAGTTGTGTTCCCAGCAATT pLKO.1 3389 3UTR 100% 10.800 7.560 N INO80 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521686.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03442 pDONR223 100% 58.2% 57.6% None 0_1ins1807;32_33ins143 n/a
2 ccsbBroad304_03442 pLX_304 0% 58.2% 57.6% V5 0_1ins1807;32_33ins143 n/a
3 TRCN0000476169 TTCGTGAAGTAGAACACGTTCACA pLX_317 8.5% 58.2% 57.6% V5 0_1ins1807;32_33ins143 n/a
Download CSV