Transcript: Human XM_011521764.2

PREDICTED: Homo sapiens FA complementation group I (FANCI), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FANCI (55215)
Length:
4594
CDS:
115..3921

Additional Resources:

NCBI RefSeq record:
XM_011521764.2
NBCI Gene record:
FANCI (55215)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521764.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242771 CAATTGCCACGAACGGTAATG pLKO_005 4403 3UTR 100% 10.800 15.120 N FANCI n/a
2 TRCN0000178990 CCATTACAATTCTGTCGCCAA pLKO.1 1833 CDS 100% 2.160 3.024 N FANCI n/a
3 TRCN0000242774 ATGTAAGCTCGGAGCTAATAT pLKO_005 1368 CDS 100% 15.000 10.500 N FANCI n/a
4 TRCN0000242773 CATGTGGAAGGCACCATTATT pLKO_005 910 CDS 100% 15.000 10.500 N FANCI n/a
5 TRCN0000242772 ACGGGCATCTGGGAGATATAG pLKO_005 3095 CDS 100% 13.200 9.240 N FANCI n/a
6 TRCN0000183723 CCCTGTGTTATTCTTTCATTT pLKO.1 3554 CDS 100% 13.200 9.240 N FANCI n/a
7 TRCN0000242770 CTAGTTCCTCATAGATCTTAT pLKO_005 1171 CDS 100% 0.000 0.000 N FANCI n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521764.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000465553 CTTCCTCATGCCCGGTCTTACAAT pLX_317 6.2% 99.9% 99.7% V5 23T>C;26C>G;3356A>T n/a
Download CSV