Transcript: Human XM_011521881.2

PREDICTED: Homo sapiens BLM RecQ like helicase (BLM), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BLM (641)
Length:
3498
CDS:
468..3407

Additional Resources:

NCBI RefSeq record:
XM_011521881.2
NBCI Gene record:
BLM (641)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521881.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004904 GCCTTTATTCAATACCCATTT pLKO.1 620 CDS 100% 10.800 15.120 N BLM n/a
2 TRCN0000273474 GCCTTTATTCAATACCCATTT pLKO_005 620 CDS 100% 10.800 15.120 N BLM n/a
3 TRCN0000004906 CGCTTATGTGATGCTCGGAAA pLKO.1 2657 CDS 100% 4.050 5.670 N BLM n/a
4 TRCN0000273476 ACCGAATCTCAATGTACATAG pLKO_005 3410 3UTR 100% 10.800 8.640 N BLM n/a
5 TRCN0000004907 GCTACATATCTGACAGGTGAT pLKO.1 1353 CDS 100% 4.050 3.240 N BLM n/a
6 TRCN0000273473 GTGCAGCAGAAGTGGATTAAT pLKO_005 1941 CDS 100% 15.000 10.500 N BLM n/a
7 TRCN0000273477 TGAATATGCTGGTCGACATTT pLKO_005 2485 CDS 100% 13.200 9.240 N BLM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521881.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05893 pDONR223 100% 69% 69% None 0_1ins1314;1843G>A n/a
2 ccsbBroad304_05893 pLX_304 0% 69% 69% V5 0_1ins1314;1843G>A n/a
3 TRCN0000477789 CTGTATGCCCATACCTTTTCTGAA pLX_317 11.4% 69% 69% V5 0_1ins1314;1843G>A n/a
Download CSV