Transcript: Human XM_011521986.3

PREDICTED: Homo sapiens tumor protein p53 binding protein 1 (TP53BP1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TP53BP1 (7158)
Length:
5968
CDS:
114..5216

Additional Resources:

NCBI RefSeq record:
XM_011521986.3
NBCI Gene record:
TP53BP1 (7158)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521986.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218999 GATACTCCTTGCCTGATAATT pLKO_005 174 CDS 100% 15.000 10.500 N TP53BP1 n/a
2 TRCN0000229638 AGAACGAGGAGACGGTAATAG pLKO_005 341 CDS 100% 13.200 9.240 N TP53BP1 n/a
3 TRCN0000229639 CAGTACTCCTATTGGTATTAG pLKO_005 2936 CDS 100% 13.200 9.240 N TP53BP1 n/a
4 TRCN0000218980 GATGCTAATACTGCAATTAAG pLKO_005 759 CDS 100% 13.200 9.240 N TP53BP1 n/a
5 TRCN0000018866 CCAGTGTGATTAGTATTGATT pLKO.1 2287 CDS 100% 5.625 3.938 N TP53BP1 n/a
6 TRCN0000018869 CCCTTGTTCAGGACAGTCTTT pLKO.1 1174 CDS 100% 4.950 3.465 N TP53BP1 n/a
7 TRCN0000321586 TGCCTAAAGAAGGTGATATTA pLKO_005 2851 CDS 100% 15.000 12.000 N Trp53bp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521986.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000465716 CCCGCTAGCACTCTAGGATCTGGA pLX_317 5.5% 85.4% .4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV