Transcript: Human XM_011522193.3

PREDICTED: Homo sapiens ubiquitin specific peptidase 8 (USP8), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP8 (9101)
Length:
4431
CDS:
380..3736

Additional Resources:

NCBI RefSeq record:
XM_011522193.3
NBCI Gene record:
USP8 (9101)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522193.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007439 CCACAGATTGATCGTACTAAA pLKO.1 1592 CDS 100% 13.200 18.480 N USP8 n/a
2 TRCN0000284767 CCACAGATTGATCGTACTAAA pLKO_005 1592 CDS 100% 13.200 18.480 N USP8 n/a
3 TRCN0000007435 GCTGTGTTACTAGCACTATAT pLKO.1 3856 3UTR 100% 13.200 10.560 N USP8 n/a
4 TRCN0000284769 GCTGTGTTACTAGCACTATAT pLKO_005 3856 3UTR 100% 13.200 10.560 N USP8 n/a
5 TRCN0000272486 CACTGGAACCTTTCGTTATTA pLKO_005 2365 CDS 100% 15.000 10.500 N USP8 n/a
6 TRCN0000272433 TCAAGCAACAGCAGGATTATT pLKO_005 615 CDS 100% 15.000 10.500 N USP8 n/a
7 TRCN0000284765 CTCGAAGAATGCAGGATTATC pLKO_005 990 CDS 100% 13.200 9.240 N USP8 n/a
8 TRCN0000007437 GCCAGAATGAAGAGGTGTCTA pLKO.1 1347 CDS 100% 4.950 3.465 N USP8 n/a
9 TRCN0000007438 GCCTTCATGTATTTGTCTCTA pLKO.1 3221 CDS 100% 4.950 3.465 N USP8 n/a
10 TRCN0000007436 CCCAGATATAACCCAGGCTAT pLKO.1 2536 CDS 100% 4.050 2.835 N USP8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522193.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02081 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02081 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466074 AAAGAAGACGGCCCAATGCCACAC pLX_317 10.5% 100% 100% V5 n/a
Download CSV