Transcript: Human XM_011522201.2

PREDICTED: Homo sapiens solute carrier family 28 member 2 (SLC28A2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC28A2 (9153)
Length:
1793
CDS:
37..1695

Additional Resources:

NCBI RefSeq record:
XM_011522201.2
NBCI Gene record:
SLC28A2 (9153)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522201.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432202 GCCTGAGGCTTTGGACGAAAT pLKO_005 461 CDS 100% 10.800 15.120 N SLC28A2 n/a
2 TRCN0000043562 GAGCTGAAATCATTACAACAT pLKO.1 1607 CDS 100% 4.950 6.930 N SLC28A2 n/a
3 TRCN0000419692 AGGCCTTACCAATCATCATTT pLKO_005 815 CDS 100% 13.200 10.560 N SLC28A2 n/a
4 TRCN0000043559 CCTTACTAACTGCTGTGGATT pLKO.1 1757 3UTR 100% 4.950 3.960 N SLC28A2 n/a
5 TRCN0000043558 GCCTCATCAAAGCTAGCGTAT pLKO.1 1159 CDS 100% 4.050 3.240 N SLC28A2 n/a
6 TRCN0000426898 CAGAACTGATCTTGGATATAC pLKO_005 687 CDS 100% 13.200 9.240 N SLC28A2 n/a
7 TRCN0000262711 GCTGAAATCATTACAACATTT pLKO_005 1609 CDS 100% 13.200 9.240 N Gm14085 n/a
8 TRCN0000043561 GATGTCTGAAGCCCTTTGAAA pLKO.1 434 CDS 100% 5.625 3.938 N SLC28A2 n/a
9 TRCN0000043560 GTGGGAATCAAGTTCTTCATA pLKO.1 1486 CDS 100% 5.625 3.938 N SLC28A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522201.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07367 pDONR223 100% 83.7% 83.4% None (many diffs) n/a
2 ccsbBroad304_07367 pLX_304 0% 83.7% 83.4% V5 (many diffs) n/a
3 TRCN0000479323 GGCTCCTCGACCCTCTAACCGCAC pLX_317 22.8% 83.7% 83.4% V5 (many diffs) n/a
4 TRCN0000488693 GCCGGCGAGTATAGGGCATCAAAG pLX_317 17.5% 83.7% 83.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV