Transcript: Human XM_011522269.3

PREDICTED: Homo sapiens solute carrier family 12 member 6 (SLC12A6), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC12A6 (9990)
Length:
3372
CDS:
1252..3294

Additional Resources:

NCBI RefSeq record:
XM_011522269.3
NBCI Gene record:
SLC12A6 (9990)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522269.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042953 CGGACATAAGAAAGCTCGAAA pLKO.1 1572 CDS 100% 4.950 6.930 N SLC12A6 n/a
2 TRCN0000042956 GCTAAATAACATGCGTGTCTA pLKO.1 2193 CDS 100% 4.950 6.930 N SLC12A6 n/a
3 TRCN0000042955 CCGGTTTGCTTTGCTTCGATT pLKO.1 3345 3UTR 100% 4.950 3.465 N SLC12A6 n/a
4 TRCN0000069260 CCATTGAAATCTTTCTGGTAT pLKO.1 2111 CDS 100% 4.950 2.970 N Slc12a6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522269.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15687 pDONR223 0% 61.9% 61.8% None 1_177del;1591_1592insTAG;2040_2041ins963 n/a
Download CSV