Transcript: Human XM_011522353.2

PREDICTED: Homo sapiens adenylate cyclase 9 (ADCY9), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADCY9 (115)
Length:
3423
CDS:
367..3372

Additional Resources:

NCBI RefSeq record:
XM_011522353.2
NBCI Gene record:
ADCY9 (115)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522353.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078358 GCCCTCAAAGAGAGGATGATT pLKO.1 1348 CDS 100% 5.625 3.938 N ADCY9 n/a
2 TRCN0000300094 GCCCTCAAAGAGAGGATGATT pLKO_005 1348 CDS 100% 5.625 3.938 N ADCY9 n/a
3 TRCN0000078361 CCACATGAGATCCAGACTGAT pLKO.1 774 CDS 100% 4.950 3.465 N ADCY9 n/a
4 TRCN0000310553 CCACATGAGATCCAGACTGAT pLKO_005 774 CDS 100% 4.950 3.465 N ADCY9 n/a
5 TRCN0000078362 GCAATCCATTATGCACGGGAA pLKO.1 1308 CDS 100% 2.160 1.512 N ADCY9 n/a
6 TRCN0000310558 GCAATCCATTATGCACGGGAA pLKO_005 1308 CDS 100% 2.160 1.512 N ADCY9 n/a
7 TRCN0000078359 GCCCAGACAGTTCTGTATTAA pLKO.1 3242 CDS 100% 15.000 9.000 N ADCY9 n/a
8 TRCN0000310555 GCCCAGACAGTTCTGTATTAA pLKO_005 3242 CDS 100% 15.000 9.000 N ADCY9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522353.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05773 pDONR223 100% 70.9% 69.9% None (many diffs) n/a
2 ccsbBroad304_05773 pLX_304 0% 70.9% 69.9% V5 (many diffs) n/a
3 TRCN0000475791 AAAAGGGTTAAATCTTGTTTCGAC pLX_317 9.1% 70.9% 69.9% V5 (many diffs) n/a
Download CSV