Transcript: Human XM_011522507.3

PREDICTED: Homo sapiens olfactory receptor family 1 subfamily F member 1 (OR1F1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OR1F1 (4992)
Length:
2012
CDS:
871..1809

Additional Resources:

NCBI RefSeq record:
XM_011522507.3
NBCI Gene record:
OR1F1 (4992)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522507.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357737 CACCTCAATGAGGTCATAATC pLKO_005 1447 CDS 100% 13.200 18.480 N OR1F1 n/a
2 TRCN0000009338 GTTCGTGGACATGGACAATTT pLKO.1 1188 CDS 100% 13.200 18.480 N OR1F1 n/a
3 TRCN0000357736 TTCGTGGACATGGACAATTTC pLKO_005 1189 CDS 100% 13.200 18.480 N OR1F1 n/a
4 TRCN0000009337 ACACCTCAATGAGGTCATAAT pLKO.1 1446 CDS 100% 13.200 9.240 N OR1F1 n/a
5 TRCN0000009335 GCACCATCATTGCTGTGTATT pLKO.1 1628 CDS 100% 13.200 9.240 N OR1F1 n/a
6 TRCN0000009336 CTCACACAGATGTATTTCGTT pLKO.1 1162 CDS 100% 3.000 2.100 N OR1F1 n/a
7 TRCN0000009339 GTTGCTGGATTATGGGTGGTT pLKO.1 1303 CDS 100% 2.640 1.848 N OR1F1 n/a
8 TRCN0000060371 CCATGTACTTCTTCCTCAGAA pLKO.1 1043 CDS 100% 4.950 2.475 Y OR10A2 n/a
9 TRCN0000188492 CCCATGTACTTCTTCCTCACA pLKO.1 1042 CDS 100% 2.640 1.320 Y Olfr317 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522507.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.