Transcript: Human XM_011522808.3

PREDICTED: Homo sapiens M-phase phosphoprotein 6 (MPHOSPH6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MPHOSPH6 (10200)
Length:
1384
CDS:
387..815

Additional Resources:

NCBI RefSeq record:
XM_011522808.3
NBCI Gene record:
MPHOSPH6 (10200)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522808.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134532 GCCAATGTTTAAATTGCCCTT pLKO.1 1145 3UTR 100% 2.160 3.024 N MPHOSPH6 n/a
2 TRCN0000134995 CAGATGAATGCTAAGCACAAA pLKO.1 600 CDS 100% 4.950 3.465 N MPHOSPH6 n/a
3 TRCN0000135352 GAGCTTGATGTGTCAGATGAA pLKO.1 648 CDS 100% 4.950 3.465 N MPHOSPH6 n/a
4 TRCN0000134408 GATGAAACAGTAGAGCTTGAT pLKO.1 636 CDS 100% 4.950 3.465 N MPHOSPH6 n/a
5 TRCN0000134489 GATGCTTCAGATGAATGCTAA pLKO.1 593 CDS 100% 4.950 3.465 N MPHOSPH6 n/a
6 TRCN0000136012 GCCAGAGCTTAAAGAGAAAGA pLKO.1 476 CDS 100% 4.950 3.465 N MPHOSPH6 n/a
7 TRCN0000135593 GTAGAGCTTGATGTGTCAGAT pLKO.1 645 CDS 100% 4.950 3.465 N MPHOSPH6 n/a
8 TRCN0000137408 GTTTGCCAGAAAGAGAGACCA pLKO.1 716 CDS 100% 2.640 1.848 N MPHOSPH6 n/a
9 TRCN0000134278 GAAGAGATGGCTAGAAGATAT pLKO.1 666 CDS 100% 13.200 7.920 N MPHOSPH6 n/a
10 TRCN0000134389 GCAGAAGAAGTTGAAGATGAA pLKO.1 621 CDS 100% 4.950 2.970 N MPHOSPH6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522808.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07566 pDONR223 100% 88.5% 88.1% None 0_1ins54;418C>G n/a
2 ccsbBroad304_07566 pLX_304 0% 88.5% 88.1% V5 0_1ins54;418C>G n/a
3 ccsbBroadEn_07567 pDONR223 100% 88.5% 88.7% None 0_1ins54;366A>G n/a
4 ccsbBroad304_07567 pLX_304 0% 88.5% 88.7% V5 0_1ins54;366A>G n/a
5 TRCN0000474447 TGCATATCCCCCGCTCTTACTGTT pLX_317 75.8% 88.5% 88.7% V5 0_1ins54;366A>G n/a
6 ccsbBroadEn_15696 pDONR223 0% 23.1% 23.1% None 0_1ins54;112_426del n/a
Download CSV