Transcript: Human XM_011522979.2

PREDICTED: Homo sapiens phospholipase A2 group XV (PLA2G15), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLA2G15 (23659)
Length:
2796
CDS:
57..1391

Additional Resources:

NCBI RefSeq record:
XM_011522979.2
NBCI Gene record:
PLA2G15 (23659)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522979.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050926 CGGCGATGGTACTGTGAACTT pLKO.1 1226 CDS 100% 4.950 6.930 N PLA2G15 n/a
2 TRCN0000050927 CCGCGAGATGATCGAGGAGAT pLKO.1 683 CDS 100% 1.350 1.890 N PLA2G15 n/a
3 TRCN0000372892 AGCAGCGTGGGTTCCTATTTC pLKO_005 546 CDS 100% 13.200 10.560 N PLA2G15 n/a
4 TRCN0000372890 ACCGAAAGCTACTTCACAATC pLKO_005 261 CDS 100% 10.800 7.560 N PLA2G15 n/a
5 TRCN0000372891 GGACACTGGATGGCAAGAATG pLKO_005 1598 3UTR 100% 10.800 7.560 N PLA2G15 n/a
6 TRCN0000050923 GTCATCATTGACTGCTGGATT pLKO.1 309 CDS 100% 4.950 3.465 N PLA2G15 n/a
7 TRCN0000050924 CCGCAAGTTCTTCCAGGACAT pLKO.1 1037 CDS 100% 4.050 2.835 N PLA2G15 n/a
8 TRCN0000050925 GAAGACCTTCTCACTGGAGTT pLKO.1 509 CDS 100% 4.050 2.835 N PLA2G15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522979.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11756 pDONR223 100% 61.1% 61.2% None 1_516del;669C>T n/a
2 ccsbBroad304_11756 pLX_304 0% 61.1% 61.2% V5 1_516del;669C>T n/a
3 TRCN0000491698 TGACGGACTGTTAATTGCACCTGC pLX_317 42.2% 61.1% 61.2% V5 1_516del;669C>T n/a
Download CSV