Transcript: Human XM_011522980.3

PREDICTED: Homo sapiens phospholipase A2 group XV (PLA2G15), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLA2G15 (23659)
Length:
2662
CDS:
469..1257

Additional Resources:

NCBI RefSeq record:
XM_011522980.3
NBCI Gene record:
PLA2G15 (23659)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011522980.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050926 CGGCGATGGTACTGTGAACTT pLKO.1 1092 CDS 100% 4.950 6.930 N PLA2G15 n/a
2 TRCN0000372892 AGCAGCGTGGGTTCCTATTTC pLKO_005 537 CDS 100% 13.200 10.560 N PLA2G15 n/a
3 TRCN0000372890 ACCGAAAGCTACTTCACAATC pLKO_005 252 5UTR 100% 10.800 7.560 N PLA2G15 n/a
4 TRCN0000372891 GGACACTGGATGGCAAGAATG pLKO_005 1464 3UTR 100% 10.800 7.560 N PLA2G15 n/a
5 TRCN0000050923 GTCATCATTGACTGCTGGATT pLKO.1 300 5UTR 100% 4.950 3.465 N PLA2G15 n/a
6 TRCN0000050924 CCGCAAGTTCTTCCAGGACAT pLKO.1 903 CDS 100% 4.050 2.835 N PLA2G15 n/a
7 TRCN0000050925 GAAGACCTTCTCACTGGAGTT pLKO.1 500 CDS 100% 4.050 2.835 N PLA2G15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011522980.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11756 pDONR223 100% 75.8% 78.1% None 1_95del;177_178ins125 n/a
2 ccsbBroad304_11756 pLX_304 0% 75.8% 78.1% V5 1_95del;177_178ins125 n/a
3 TRCN0000491698 TGACGGACTGTTAATTGCACCTGC pLX_317 42.2% 75.8% 78.1% V5 1_95del;177_178ins125 n/a
Download CSV