Transcript: Human XM_011523151.2

PREDICTED: Homo sapiens HYDIN axonemal central pair apparatus protein (HYDIN), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HYDIN (54768)
Length:
15476
CDS:
30..15476

Additional Resources:

NCBI RefSeq record:
XM_011523151.2
NBCI Gene record:
HYDIN (54768)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523151.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130229 CCACAGATCATCGAACTCTTA pLKO.1 324 CDS 100% 4.950 3.465 N HYDIN n/a
2 TRCN0000130761 GCTGCTATCAGGGTGACATTA pLKO.1 2073 CDS 100% 13.200 6.600 Y HYDIN n/a
3 TRCN0000129902 GTACGAAACATTGGCAACAAA pLKO.1 777 CDS 100% 5.625 2.813 Y HYDIN n/a
4 TRCN0000129244 CCTGAATGACACACTGACATT pLKO.1 2726 CDS 100% 4.950 2.475 Y HYDIN n/a
5 TRCN0000128459 GATACCCACTATTACCACTTT pLKO.1 2883 CDS 100% 4.950 2.475 Y HYDIN n/a
6 TRCN0000128953 GCACATTGTTATGAGGCGATA pLKO.1 1542 CDS 100% 4.050 2.025 Y HYDIN n/a
7 TRCN0000129853 GCAATTGATGTGATACTCGAA pLKO.1 3111 CDS 100% 2.640 1.320 Y HYDIN n/a
8 TRCN0000130077 CGCAGTAATATCATTGCCCAT pLKO.1 1080 CDS 100% 2.160 1.080 Y HYDIN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523151.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12076 pDONR223 100% 13.6% 13.4% None (many diffs) n/a
2 ccsbBroad304_12076 pLX_304 0% 13.6% 13.4% V5 (many diffs) n/a
3 TRCN0000477734 AATGACCAAATATTACATGCCAAC pLX_317 14.5% 13.6% 13.4% V5 (many diffs) n/a
Download CSV